citB [2020-09-10 09:29:50]

aconitase, trigger enzyme

locus: BSU_18000

pI: 4.90

mw: 99.14 kDa

protein length: 909 aa

gene length: 2730 bp

function: TCA cycle

product: aconitase, trigger enzyme

essential: no

ec: 4.2.1.3

synonyms

Genomic Context

categories

• [category|SW 2|Metabolism] → [category|SW 2.2|Carbon metabolism] → [category|SW 2.2.1|Carbon core metabolism] → [category|SW 2.2.1.4|TCA cycle]
• [category|SW 2|Metabolism] → [category|SW 2.3|Amino acid/ nitrogen metabolism] → [category|SW 2.3.2|Utilization of amino acids] → [category|SW 2.3.2.9|Utilization of branched-chain amino acids]
• [category|SW 3|Information processing] → [category|SW 3.4|Regulation of gene expression] → [category|SW 3.4.3|Trigger enzyme] → [category|SW 3.4.3.4|Trigger enzyme that acts by binding of a specific RNA element]
• [category|SW 3|Information processing] → [category|SW 3.4|Regulation of gene expression] → [category|SW 3.4.4|RNA binding regulators]

Gene

Coordinates: 1,926,680 → 1,929,409

Phenotypes of a mutant

• glutamate auxotrophy and a defect in sporulation [Pubmed|9393699]

The protein

Catalyzed reaction/ biological activity

• Citrate --> isocitrate (according to UniProt)
• 3-hydroxybutane-1,2,3-tricarboxylate --> 2-methyl-cis-aconitate + H₂O (according to UniProt)
• Binding to iron responsive elements (IRE RNA) in the absence of the FeS cluster [Pubmed|23354745,10468622]
• 2-methylaconitate --> 2-methyl-isocitrate in the methylcitric acid cycle [pubmed|28956599]

Protein family

• aconitase/IPM isomerase family (with [protein|AC459429A9C50463FD947C1CF9EA919B6FE3B335|LeuC], according to UniProt)

[SW|Cofactors]

• FeS cluster [pubmed|29292548]

Structure

• [PDB|2B3X] (the human enzyme, 53% identity) [pubmed|16407072]

Additional information

• ''B. subtilis'' aconitase is both an enzyme and an RNA binding protein ([SW|moonlighting protein]) [Pubmed|10468622]
• extensive information on the structure and enzymatic properties of CitB can be found at [http://www.proteopedia.org/wiki/index.php/Aconitase Proteopedia]
• belongs to the 100 [SW|most abundant proteins] [PubMed|15378759]

Expression and Regulation

Operons

• genes: [gene|E15E9F88B0E03FE8834C646369D2F4B4E713EF41|citB]-[gene|50BBC8AB77B99B9FE5B8A8FE906D39DFEA4ED652|yneN]
  description: [Pubmed|22383849]

  sigma factors

  • [protein|360F48D576DE950DF79C1A2677B7A35A8D8CC30C|SigA]: sigma factor, [Pubmed|1310745], in [regulon|360F48D576DE950DF79C1A2677B7A35A8D8CC30C|SigA regulon]

  regulatory mechanism

  • [protein|90ACE0DECA58D3C1A55E135120F7A0C1C920571C|CodY]: repression, [Pubmed|12591885], in [regulon|90ACE0DECA58D3C1A55E135120F7A0C1C920571C|CodY regulon]
  • [protein|FE15A41A58A8177280817CA3825764C39185021A|CcpC]: repression, (molecular inducer: citrate) [pubmed|10656796] [pubmed|12100558], in [regulon|FE15A41A58A8177280817CA3825764C39185021A|CcpC regulon]
  • [protein|E39AFEB7B7F28969A35C4B51CC6E7819F71C79D9|CcpA]: repression, [Pubmed|12100558], in [regulon|E39AFEB7B7F28969A35C4B51CC6E7819F71C79D9|CcpA regulon]

  regulation

  • expressed upon transition into the stationary phase ([protein|search|AbrB]) [Pubmed|12591885], indirect negative regulation by [protein|search|AbrB] [Pubmed|20817675]

Other regulations

• [protein|CE542AE1A32CCD1ABB259E6159F7A37A8078E189|FsrA]: translation repression, [Pubmed|18697947]

Biological materials

Mutant

• GP1275 Δ''citB''::''erm'', available in [SW|Jörg Stülke]'s lab
• GP1441 ΔcitB::spc, available in [SW|Jörg Stülke]'s lab
• 1A999 (''citB'')::''spec'', [Pubmed| ], available at [http://pasture.asc.ohio-state.edu/BGSC/getdetail.cfm?bgscid=1A999&Search=1A999 BGSC]
• GP2338 Δ''[gene|E15E9F88B0E03FE8834C646369D2F4B4E713EF41|citB]''::''kan'', Cre-recombinase is integrated in ''[gene|8C2DD87E0351BBEE0FD8C0462087CCAD7459AA88|sacA]'', available in [SW|Jörg Stülke]'s lab
• GP2339 Δ''[gene|E15E9F88B0E03FE8834C646369D2F4B4E713EF41|citB]''::''lox72'', Cre-recombinase is integrated in ''[gene|8C2DD87E0351BBEE0FD8C0462087CCAD7459AA88|sacA]'', available in [SW|Jörg Stülke]'s lab
• BKE18000 (Δ[gene|E15E9F88B0E03FE8834C646369D2F4B4E713EF41|citB]::erm trpC2)available at [http://www.bgsc.org/getdetail.php?bgscid=BKE18000 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATTCTCCAAAATCCCCCTT, downstream forward: _UP4_TGATGAATCAATAGGAAGAG
• BKK18000 (Δ[gene|E15E9F88B0E03FE8834C646369D2F4B4E713EF41|citB]::kan trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKK18000 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATTCTCCAAAATCCCCCTT, downstream forward: _UP4_TGATGAATCAATAGGAAGAG

Expression vector

• pGP1810 (N-terminal Strep-tag, purification from ''E. coli'', in [SW|pGP172]), available in [SW|Jörg Stülke]'s lab

lacZ fusion

• pGP700 (in [SW|pAC5]), available in [SW|Jörg Stülke]'s lab

GFP fusion

• GP1434 (spc, based on [SW|pGP1870]), available in [SW|Jörg Stülke]'s lab

two-hybrid system

• ''B. pertussis'' adenylate cyclase-based bacterial two hybrid system ([SW|BACTH]), available in [SW|Jörg Stülke]'s lab

FLAG-tag construct

• GP1144 (spc, based on [SW|pGP1331]), available in [SW|Jörg Stülke]'s lab
• GP1145 (kan), available in [SW|Jörg Stülke]'s lab

Antibody

• available in [SW|Linc Sonenshein]'s lab

labs

• [SW|Linc Sonenshein], Tufts University, Boston, MA, USA [http://www.tufts.edu/sackler/microbiology/faculty/sonenshein/index.html Homepage]
• [SW|Jörg Stülke], University of Göttingen, Germany [http://genmibio.uni-goettingen.de Homepage]

References

Reviews

• 12732309,2696478,18261896,18086213

Original publications

• 18697947,20097860,2118511,12850135,2413006,10656796,10468622,6143742,16395550,16923907,9642180,9393699,12591885,2105305,20933603,21099137,21446632,21821766,22389480,23139400,23354745,20817675,15378759,16923908,21744456,11992126,28956599,16407072